Questões de Genética - Perguntas e Respostas Comentadas - Exercícios
questões de vestibulares
|

 

Questões Genética


REF. Perguntas / Respostas
vestibular UFSCar
tópico:Genética

sub-grupo:
pergunta:Suponha um organismo diplóide, 2n = 4, e a existência de um gene A em um dos pares de cromossomos homólogos e de um gene B no outro par de homólogos.
Um indivíduo heterozigótico para os dois genes formará a) 2 tipos de gametas na proporção 1:1.
b) 2 tipos de gametas na proporção 3:1.
c) 4 tipos de gametas nas proporções 9:3:3:1.
d) 4 tipos de gametas nas proporções 1:1:1:1.
e) 4 tipos de gametas na proporção 1:2:1.


resposta:O genótipo para o indivíduo é AaBb.
Na gametogênese esse indivíduo formará 2n (n = número de pares em heterozigose) gametas diferentes; no caso, 4, na proporção de 1/4:1/4:1/4:1/4.
Resp.
: D

vestibular UFSCar
tópico:Genética

sub-grupo:
pergunta:A hemofilia é uma doença recessiva ligada ao sexo, que se caracteriza pela dificuldade de coagulação do sangue.
Em um casal em que a mulher é heterozigota para a hemofilia e o marido é normal, a probabilidade de nascimento de uma criança do sexo masculino e hemofílica é a) 1/2.
b) 1/3.
c) 1/4.
d) 1/8.
e) 3/4.


resposta:C

vestibular UFSCar
tópico:Genética

sub-grupo:
pergunta:Um pesquisador, interessado em produzir em tubo de ensaio uma proteína, nas mesmas condições em que essa síntese ocorre nas células, utilizou ribossomos de células de rato, RNA mensageiro de células de macaco, RNA transportador de células de coelho e aminoácidos ativos de células de sapo.
A proteína produzida teria uma seqüência de aminoácidos idêntica à do a) rato.
b) sapo.
c) coelho.
d) macaco.
e) macaco e do rato.


resposta:D

vestibular UEL
tópico:Genética

sub-grupo:
pergunta:Uma criança necessita urgentemente de uma transfusão de sangue.
Seu pai tem sangue do tipo B e sua mãe, do tipo O.
Que outro(s) tipo(s) de sangue, além do tipo O, poderia(m) ser utilizado(s) na transfusão, mesmo sem a realização de teste, sabendo-se que o avô paterno da criança tem sangue do tipo AB e sua avó paterna tem sangue do tipo O?
a) Tipo AB.
b) Tipo A.
c) Tipo B.
d) Tipo A e tipo B.
e) Nenhum outro tipo.


resposta:E

vestibular UEL
tópico:Genética

sub-grupo:
pergunta:Sabe-se que o albinismo é determinado pela ação de um gene recessivo autossômico.
Considere um casal normal que teve 6 crianças todas normais.
Sabendo-se que o avô paterno e a avó materna das crianças eram albinos, podemos afirmar com certeza que a probabilidade de um novo filho vir a ser albino (sem considerar o sexo), será: a) 0% b) 25% c) 50% d) 75% e) 100%

resposta:B

vestibular UEL
tópico:Genética

sub-grupo:
pergunta:Considere quatro pares de genes que segregam de maneira independente.
Nessas condições, um indivíduo que apresente o genótipo AaBBCcDD produzirá gametas ABCD com a freqüência de:
a) 75%.
b) 50%.
c) 25%.
d) 12%.
e) 6,25%.


resposta:C

vestibular UEL
tópico:Genética

sub-grupo:
pergunta:Em seres humanos, uma forma de daltonismo que provoca cegueira para as cores vermelho e verde, é determinada pelo gene recessivo d, ligado ao cromossomo X.
Ao consultar um médico, um casal fica sabendo que todos os seus filhos do sexo masculino serão daltônicos; já as meninas serão normais.
Qual das opções fenotípicas abaixo corresponde à do casal em questão?
a) Homem normal e mulher normal.
b) Homem normal e mulher daltônica.
c) Homem daltônico e mulher daltônica.
d) Homem daltônico e mulher normal.
e) Homem normal e mulher normal, porém portadora de gene recessivo d.


resposta:B

vestibular UEL
tópico:Genética

sub-grupo:
pergunta:Na natureza, indivíduos de espécies diferentes raramente se acasalam.
Algumas vezes isso acontece, resultando em embriões que não se desenvolvem ou em descendentes estéreis ou de fertilidade reduzida.
Esse esforço reprodutivo, que nem sempre compensa, é resultado de: a) Recombinação gênica.
b) Mutação gênica.
c) Mecanismos que favorecem o acasalamento entre espécies diferentes.
d) Mecanismos que conduzem ao isolamento reprodutivo.
e) Ligação e permuta genética.


resposta:D

vestibular Outros
tópico:Genética

sub-grupo:
pergunta:Em 1953, em um breve artigo na revista Nature, os pesquisadores J.
Watson e H. C.Crick propuseram um modelo para a estrutura da molécula de DNA.
Hoje, cinqüenta anos após, a molécula de DNA ainda é o foco de muitas discussões, pois as modernas técnicas de biologia molecular prometem causar uma revolução na vida dos homens.
Considerando esta molécula, responda aos itens abaixo.
a) Cite duas características da molécula de DNA, de acordo com o modelo proposto pelos pesquisadores acima.
b) Cite uma característica do processo de replicação da molécula de DNA em seres eucariontes.
c) Para a síntese protéica, cada trinca de bases da molécula de DNA corresponde a um aminoácido na proteína.
O DNA, entretanto, não participa diretamente da síntese de proteínas.
Cite a molécula que atua como intermediária neste processo.
d) A enzima de restrição EcoRI apresenta o seguinte sítio de clivagem:
G¯ AATTC
C­ TTAAG

Demonstre como ficará o fragmento de DNA representado abaixo, após a atuação dessa enzima.
5’AAGGTTCGAATTCAGTATATAACAGAATTCCCGGTA 3’
3’TTCCAAGCTTAAGTCATCAATTGTCTTAAGGGCCAT 5’

e) O seqüenciamento completo do genoma humano foi anunciado em 2003.
Explique o que se entende por seqüenciamento do genoma.


resposta:a) – Apresenta complementaridade das bases nitrogenadas; seus filamentos apresentam direções anti-paralelas.
b) É um processo semi-conservativo.
c) RNA d) 5’ AAGGTTCG 3’ 5’ AATTCAGTATATAACAG 3’ 5’ AATTCCCGGTA 3’ 3’ TTCCAAGC 5’ 3’ TTAAGTCATATATTGAC 5’ 3’ TTAAGGGCCAT 5’ e) O seqüenciamento do genoma significa a determinação da seqüência de bases nitrogenadas que compõem o genoma de determinada espécie.


vestibular UNIFESP
tópico:Genética

sub-grupo:
pergunta:Alguns grupos radicalmente contrários ao uso de organismos geneticamente modificados (transgênicos) na agricultura divulgaram recentemente, no Sul do país, um folheto à população alertando sobre os perigos da ingestão de transgênicos na alimentação.
Entre as advertências, constava uma que afirmava incorretamente que “para serem criadas plantas transgênicas são usados os vírus da AIDS” e que tais plantas, se ingeridas, poderiam infectar com o vírus da AIDS toda a população.
a) O que são transgênicos ou organismos geneticamente modificados (OGMs)?
b) Explique por que o vírus da AIDS não poderia infectar uma planta e por que a ingestão de uma planta transgênica não seria capaz de transmitir o vírus da AIDS.


resposta:São organismos que receberam e incorporaram gene(s) de uma outra espécie em seu genoma.
b) O vírus da AIDS não infecta plantas porque nas plantas não há receptores de membrana para que o vírus possa reconhecê-la e fixar-se, com posterior infecção.
Contudo, se fosse possível a infecção, a planta transgênica não seria capaz de transmitir o vírus da AIDS devido à ação digestiva que o mesmo sofreria.
Em nosso tubo digestório existem enzimas que digeririam o RNA viral, bem como as glicoproteínas e lipídeos nele encontrados.


vestibular Fuvest-2ª-fase-2006
tópico:Genética

sub-grupo:
pergunta:No heredograma, estão representadas pessoas que têm uma doença determinada por um alelo mutante dominante em relação ao alelo normal.


resposta:a) A doença tem padrão de herança autossômica; tal conclusão é resultante da análise do caráter do indivíduo II-5.
Se a doença fosse ligada ao sexo dominante, mães normais gestariam crianças de sexo masculino sempre normais.
b) Os indivíduos III-7 e III-8 são Aa, isto é, são heterozigotos.
c) Afetado – dominante:
A Normal – recessivo:
a Probabilidade da criança, de sexo feminino, ser aa (normal) é igual a 1/4 ou 25%.


vestibular Fuvest-2ª-fase-2004
tópico:Genética

sub-grupo:
pergunta:“Os genomas de dois parasitas que causam a esquistossomose foram seqüenciados, um passo que pode levar a vacinas para tratar e erradicar a doença. A esquistossomose causa mais enfermidade do que qualquer outra doença parasitária, com exceção da malária.”(New Scientist, 20/09/03) a) O que significa dizer que os genomas dos dois parasitas foram seqüenciados?
b) A que reinos de seres vivos pertencem os agentes causadores da malária e da esquistossomose?
c) Qual é a maneira mais comum de uma pessoa contrair malária?
d) Como uma pessoa contrai esquistossomose?


resposta:a) Significa dizer que foi obtida a seqüência completa das bases do DNA dos parasitas.
b) A malária é doença causada pelo protozoário chamado Plasmodium pertencente ao reino Protista.
A esquistossomose é provocada pelo verme Schistosoma mansoni, incluído no reino Animal. c) Picada do mosquito Anopheles (mosquito-prego fêmea) contaminado com o parasita.
d) Nadando em águas contaminadas com as larvas cercárias.

 
celula virtual - para ensino medio

 




morfologia sistema circulatorio arterias, veias e coração